Bacillus sporothermodurans

Thirty-eight strains of Bacillus sporothermodurans isolated from ultra-high-temperature (UHT)-treated milk or sterilized milk (UHT isolates) and from animal feed or raw milk (farm isolates) were characterized by automated ribotyping and by repetitive extragenic palindromic (REP)-PCR fingerprinting. Tiga puluh delapan strain Bacillus sporothermodurans terisolasi dari suhu-tinggi-ultra (UHT)-diperlakukan susu atau disterilkan susu (UHT isolat) dan dari pakan ternak atau susu mentah (pertanian isolat) yang ditandai dengan ribotyping otomatis dan berulang palindromic extragenic (REP )-PCR fingerprinting. By investigating the genetic relationships among isolates from these various sources, the relative importance of different contamination sources could be evaluated. Dengan menyelidiki hubungan genetik di antara isolat dari berbagai sumber, kepentingan relatif dari sumber kontaminasi yang berbeda dapat dievaluasi. The results of the separate clustering analyses of the Pvu II and Eco RI ribopatterns and the REP-PCR patterns were largely consistent with each other and revealed the existence of two main clusters; there was one homogeneous group containing all (REP-PCR) or most (ribotyping) of the UHT isolates, and there was a second more diverse group comprising the farm isolates. Hasil analisis pengelompokan terpisah II Pvu dan RI Eco ribopatterns dan pola REP-PCR sebagian besar konsisten satu sama lain dan mengungkapkan adanya dua kelompok utama; ada satu kelompok homogen yang berisi semua (REP-PCR) atau paling (ribotyping) dari UHT isolat, dan ada kelompok yang lebih beragam yang terdiri dari kedua isolat peternakan. A combined three-dimensional analysis of all data showed that three German UHT isolates did not belong to the compact group containing the majority of the UHT isolates. Analisis tiga dimensi gabungan semua data menunjukkan bahwa tiga UHT Jerman isolat tidak termasuk dalam kelompok kompak yang berisi mayoritas UHT isolat. These results demonstrate that B. Hasil ini menunjukkan bahwa B. sporothermodurans is more heterogeneous than previously assumed and that most of the UHT isolates form a genetically distinct subgroup and are capable of producing highly heat-resistant spores. sporothermodurans lebih heterogen dari sebelumnya diasumsikan dan bahwa sebagian besar UHT isolat membentuk sub-kelompok genetik yang berbeda dan mampu memproduksi spora tahan panas tinggi. The close genetic relationship of these UHT isolates suggests a clonal origin of a few predominant strains of B. Hubungan genetik dekat UHT isolat ini menunjukkan sumber berasal dari klon dari beberapa strain utama B. sporothermodurans that can be found in UHT-treated or sterilized milk products. sporothermodurans yang dapat ditemukan di UHT-diperlakukan atau disterilkan produk susu.
• OTHER SECTIONS▼ BAGIAN LAINNYA ▼
O ABSTRACT ABSTRAK
O MATERIALS AND METHODS BAHAN DAN METODE
O RESULTS HASIL
O DISCUSSION DISKUSI
O REFERENCES DAFTAR PUSTAKA
Mesophilic aerobic sporeformers with extremely high heat resistance were first detected in ultra-high-temperature (UHT)-treated milk from southern Europe in 1985; later they were also detected in other countries in and outside Europe ( 6 , 8 , 17 ). Sporeformers aerobik mesofilik dengan ketahanan panas yang sangat tinggi pertama kali terdeteksi pada suhu-tinggi-ultra (UHT)-diperlakukan susu dari Eropa Selatan pada tahun 1985, kemudian mereka juga terdeteksi di negara-negara lain di dalam dan di luar Eropa ( 6 , 8 , 17 ). These sporeformers belonged to the genus Bacillus and were recently classified as a new species, Bacillus sporothermodurans ( 20 ). Sporeformers ini berasal dari Bacillus genus dan baru-baru ini diklasifikasikan sebagai spesies baru, Bacillus sporothermodurans ( 20 ).
According to its original description ( 20 ), an important characteristic of B. Menurut deskripsi asli ( 20 ), sebuah ciri penting B. sporothermodurans is its ability to produce highly heat-resistant spores (HRS) that may survive sterilization (115 to 120°C for 15 to 20 min) or UHT treatment (135 to 142°C for a few seconds). sporothermodurans adalah kemampuannya untuk menghasilkan spora tahan panas tinggi (HRS) yang dapat bertahan hidup sterilisasi (115 sampai 120 ° C selama 15 sampai 20 menit) atau perlakuan UHT (135-142 ° C selama beberapa detik). Huemer et al. Huemer et al. ( 16 ) found D values at 140°C that varied between 3.4 and 7.9 s and z values that varied between 13.1 and 14.2°C for spore preparations from the original stock culture, but they also observed a significant decrease in the heat resistance after multiple laboratory culture passages. ( 16 ) menemukan nilai D pada 140 ° C yang bervariasi antara 3,4 dan 7,9 s dan z nilai-nilai yang bervariasi antara 13,1 dan 14,2 ° C untuk persiapan spora dari budaya saham asli, tetapi mereka juga mengamati penurunan yang signifikan dalam perlawanan panas setelah beberapa laboratorium bagian budaya. Surviving spores of B. Penggabungan spora B. sporothermodurans can germinate and multiply in products to a maximal concentration of ca. sporothermodurans dapat tumbuh dan berkembang biak dalam produk untuk konsentrasi maksimal ca. 10 5 cells/ml. 10 5 sel / ml. Although the vegetative cells are not pathogenic ( 9 , 10 ) and do not cause significant visual or taste deviations, their presence in sterilized and UHT-treated products is considered undesirable, as such products do not meet the legal requirements established by the European Union ( 1 ). Meskipun sel vegetatif tidak patogen ( 9 , 10 ) dan tidak menyebabkan penyimpangan visual atau rasa yang signifikan, kehadiran mereka di steril dan yang diobati dengan produk UHT dianggap tidak diinginkan, karena produk tersebut tidak memenuhi persyaratan hukum yang didirikan oleh Uni Eropa ( 1 ).
For detection and identification of B. Untuk deteksi dan identifikasi B. sporothermodurans in raw and consumer milk, a PCR-based method, now called HRS-PCR ( 22 ), was developed by Herman et al. sporothermodurans dalam susu mentah dan konsumen, sebuah metode berbasis PCR, sekarang disebut HRS-PCR ( 22 ), dikembangkan oleh Herman et al. ( 13 ). ( 13 ). Several molecular methods have been used successfully to differentiate and characterize B. Beberapa metode molekuler telah berhasil digunakan untuk membedakan dan mencirikan B. sporothermodurans strains, including PCR methods like random amplified polymorphic DNA analysis, repetitive extragenic palindromic (REP)-PCR, and 16S ribosomal DNA (rDNA) sequence analysis ( 12 , 18 , 20 ). sporothermodurans strain, termasuk metode PCR seperti analisis amplifikasi DNA polimorfik acak, palindromic extragenic berulang (REP)-PCR, dan 16S ribosomal DNA (rDNA) analisis urutan ( 12 , 18 , 20 ). All these techniques showed that the different B. Semua ini menunjukkan bahwa teknik yang berbeda B. sporothermodurans strains isolated so far from European UHT-treated and sterilized milk are phylogenetically very closely related, forming the so-called HRS clone, named after the initial description of this highly heat-resistant spore-forming organism ( 8 ). sporothermodurans strain terisolasi begitu jauh dari Eropa UHT-diperlakukan dan disterilkan susu phylogenetically sangat erat kaitannya, disebut HRS membentuk klon-jadi, yaitu setelah deskripsi awal ini membentuk spora-organisme yang sangat tahan panas ( 8 ). Recently, B. Baru-baru ini, B. sporothermodurans strains have also been isolated from raw milk and from animal feed ( 4 , 22 , 24 ). sporothermodurans strain juga telah diisolasi dari susu mentah dan dari pakan ternak ( 4 , 22 , 24 ). The majority of these farm isolates reacted negatively in the HRS-PCR of Herman et al. Sebagian lahan tersebut isolat bereaksi negatif di HRS-PCR Herman et al. ( 13 ) but could be assigned to B. ( 13 ), tetapi dapat diberikan ke B. sporothermodurans by a polyphasic approach and/or a new 16S rDNA-based specific PCR identification test ( 22 ). sporothermodurans dengan pendekatan polyphasic dan / atau 16S baru tertentu tes PCR identifikasi berbasis rDNA ( 22 ).
The purpose of the present study was to evaluate the genetic diversity of B. Tujuan dari penelitian ini adalah untuk mengevaluasi keragaman genetik B. sporothermodurans isolates by using two molecular typing techniques (ribotyping and REP-PCR) targeted at different genomic sites as recommended by different authors ( 14 , 25 ). sporothermodurans isolat dengan menggunakan teknik mengetik dua molekul (ribotyping dan REP-PCR) ditargetkan pada situs genom yang berbeda seperti yang direkomendasikan oleh penulis yang berbeda ( 14 , 25 ). REP-PCR has been recognized to be highly discriminatory for the differentiation of many bacterial species, including Escherichia coli and B. REP-PCR telah diakui menjadi sangat diskriminatif untuk diferensiasi spesies bakteri, termasuk Escherichia coli dan B. sporothermodurans ( 5 , 11 , 12 , 18 ). sporothermodurans ( 5 , 11 , 12 , 18 ). In addition, ribotyping has proved to be useful for differentiation at the subspecies level, as demonstrated for species like Pseudomonas aeruginosa , Vibrio cholerae , Listeria monocytogenes , and Clostridium botulinum ( 3 , 7 , 19 , 23 ). Selain itu, ribotyping telah terbukti berguna untuk diferensiasi pada tingkat subspesies, seperti yang ditunjukkan untuk spesies seperti aeruginosa Pseudomonas, Vibrio cholerae, Listeria monocytogenes, Clostridium botulinum dan ( 3 , 7 , 19 , 23 ). Both DNA fingerprinting techniques were applied to B. DNA fingerprinting Kedua teknik yang diterapkan ke B. sporothermodurans strains isolated from a wide range of geographic areas, including Asia, South America, and Europe, and from different sources, as outlined above. sporothermodurans strain terisolasi dari berbagai wilayah geografis, termasuk Asia, Amerika Selatan, dan Eropa, dan dari sumber yang berbeda, seperti diuraikan di atas. The resulting genetic relationships found among the strains should allow workers to determine the relative contributions of different possible contamination sources. Hubungan genetik yang dihasilkan ditemukan di antara strain harus memungkinkan pekerja untuk menentukan kontribusi relatif dari berbagai sumber kontaminasi mungkin.
• OTHER SECTIONS▼ BAGIAN LAINNYA ▼
O ABSTRACT ABSTRAK
O MATERIALS AND METHODS BAHAN DAN METODE
O RESULTS HASIL
O DISCUSSION DISKUSI
O REFERENCES DAFTAR PUSTAKA
MATERIALS AND METHODS BAHAN DAN METODE
Bacterial strains used and isolation of new B. Bakteri yang digunakan strain dan isolasi B. baru sporothermodurans strains. sporothermodurans strain.
The isolates from European UHT-treated and sterilized milk and the isolates from raw milk and animal feed (feed concentrate, silage, pulp, soy) have been described previously ( 12 , 22 , 24 ). Isolat dari UHT Eropa-diperlakukan dan disterilkan susu dan isolat dari susu mentah dan pakan ternak (pakan konsentrat, silase, pulp, kedelai) telah dijelaskan sebelumnya ( 12 , 22 , 24 ). A total of 2,113 UHT-treated or sterilized milk samples were collected worldwide (Pakistan, Ecuador, Dominican Republic, Mexico) in local supermarkets and factories during the second half of 1998. Sebanyak 2.113 UHT-diperlakukan atau disterilkan sampel susu dikumpulkan di seluruh dunia (Pakistan, Ekuador, Republik Dominika, Meksiko) di supermarket lokal dan pabrik-pabrik pada paruh kedua 1998. The products were incubated for 5 to 7 days at 37°C, and 0.1 ml of each product was streaked onto brain heart infusion broth (Oxoid) supplemented with vitamin B 12 (1 mg/liter; Sigma) and bacteriological agar 1 (15 g/liter; Oxoid) (pH 6.8). Produk diinkubasi selama 5 sampai 7 hari pada suhu 37 ° C, dan 0,1 ml masing-masing produk infus melesat ke jantung kaldu otak (Oxoid) ditambah dengan vitamin (B 1 mg / liter; Sigma) dan bakteriologis agar 12 1 (15 g / liter; Oxoid) (pH 6.8). Petri dishes were incubated at 37°C for 2 days. cawan Petri diinkubasi pada suhu 37 ° C selama 2 hari. Typical colonies of B. Khas koloni B. sporothermodurans ( 20 ) and also spores were identified by phase-contrast microscopy and retained. sporothermodurans ( 20 ) serta spora diidentifikasi dengan mikroskop fase kontras dan ditahan. All of the strains are listed in Table 1 , including B. Semua strain tercantum dalam Tabel 1 , termasuk B. sporothermodurans type strain MB 581 (= DSMZ 10599) and a raw milk isolate of Bacillus oleronius , the closest phylogenetic neighbor of B. sporothermodurans jenis strain MB 581 (= DSMZ 10.599) dan susu mentah oleronius isolat Bacillus, tetangga terdekat filogenetik B. sporothermodurans ( 4 , 10 , 22 ). sporothermodurans ( 4 , 10 , 22 ).

TABLE 1. TABEL 1.
B. sporothermodurans and B. B. sporothermodurans dan B. oleronius strains used in this study and their origins a oleronius strain yang digunakan dalam penelitian ini dan asal-usul mereka yang
Identification of presumptive B. Identifikasi B. dugaan sporothermodurans isolates. sporothermodurans isolat.
Presumptive B. Dugaan B. sporothermodurans colonies were identified by two PCR methods. sporothermodurans koloni diidentifikasi dengan dua metode PCR. The first method, HRS-PCR ( 22 ) performed with sequences obtained by subtractive hybridization, was performed with the primers SH2-F1 (5′GATTCAGGCAGAATGTAGCA3′) and SH2-R (5′TTTCGCCACTTGATGGTACA3′) (Microsynth AG, Balgach, Switzerland) as described by Herman et al. Metode pertama, HRS-PCR ( 22 ) dilakukan dengan urutan yang diperoleh subtraktif hibridisasi, dilakukan dengan primer SH2-F1 (5'GATTCAGGCAGAATGTAGCA3 ') dan SH2-R (5'TTTCGCCACTTGATGGTACA3') (Microsynth AG, Balgach, Swiss) seperti yang dijelaskan oleh Herman et al. ( 13 ). ( 13 ). In addition, a newly developed primer pair, F2 (5′ACGGCTCAACCGTGGAG3′) and R2 (5′GTAACCTCGCGGTCTA3′), for amplification of a B. Selain itu, pasangan yang baru dikembangkan primer, F2 (5'ACGGCTCAACCGTGGAG3 ') dan R2 (5'GTAACCTCGCGGTCTA3'), untuk amplifikasi dari B. sporothermodurans -specific 16S rDNA fragment was used as described by Scheldeman et al. spesifik 16S rDNA fragmen-sporothermodurans digunakan seperti yang dijelaskan oleh Scheldeman et al. ( 22 ). ( 22 ).
Automated ribotyping and data analysis. Otomatis ribotyping dan analisis data.
All B. Semua B. sporothermodurans isolates were processed at least two times by using the automated microbial characterization system (RiboPrinter; Qualicon, Inc., Wilmington, Del.) and restriction enzymes Eco RI and Pvu II (Qualicon) as described elsewhere ( 2 ). sporothermodurans isolat diproses setidaknya dua kali dengan menggunakan sistem karakterisasi mikroba otomatis (RiboPrinter; Qualicon, Inc, Wilmington, Del) dan enzim restriksi Eco RI dan Pvu II (Qualicon) seperti yang dijelaskan di tempat lain ( 2 ). All ribopatterns with similarity coefficients higher than 0.93 were considered identical by the RiboPrinter software and were grouped together based on the position and intensity of the bands to form a ribogroup (a set of isolates with indistinguishable ribotypes). Semua ribopatterns dengan koefisien kesamaan lebih tinggi dari 0,93 dianggap identik dengan perangkat lunak RiboPrinter dan dikelompokkan berdasarkan posisi dan intensitas dari band untuk membentuk ribogroup (satu set isolat dengan ribotypes dibedakan). Further refinement of the automated ribogrouping was performed by visual evaluation of closely related ribopatterns, which resulted in merger or separation of ribogroups. perbaikan lebih lanjut dari ribogrouping otomatis dilakukan oleh evaluasi visual ribopatterns erat terkait, yang mengakibatkan penggabungan atau pemisahan ribogroups.
REP-PCR. REP-PCR.
Total genomic DNA from purified B. Total genom DNA dari B. dimurnikan sporothermodurans strains was isolated by using the method of Pitcher et al. sporothermodurans strain diisolasi dengan menggunakan metode Pitcher et al. ( 21 ), as slightly modified by Heyndrickx et al. ( 21 ), dengan sedikit dimodifikasi oleh Heyndrickx et al. ( 15 ), and the DNA concentration was determined with a spectrophotometer. ( 15 ), dan konsentrasi DNA ditentukan dengan spektrofotometer. Total genomic DNA (25 ng) was used as the template in REP-PCR performed with primers REP1R-I (5′ IIIICGICGICATCIGGC3′) and REP2-I (5′ICGICTTATCIGGCCTAC3′) (Isogen Bioscience bv), and the REP fragments were separated by denaturing polyacrylamide gel electrophoresis and silver stained as described by Herman et al. Total genomik DNA (25 ng) digunakan sebagai template di REP-PCR dilakukan dengan primer REP1R-I (5 'IIIICGICGICATCIGGC3') dan REP2-I (5'ICGICTTATCIGGCCTAC3 ') (Isogen Biosains bv), dan fragmen REP dipisahkan dengan dipisahkan oleh medan listrik gel poliakrilamida dan perak ternoda seperti yang dijelaskan oleh Herman et al. ( 12 ). ( 12 ). All strains were analyzed in the same REP-PCR experiment and on the same gel to minimize possible variations in patterns caused by experimentation ( 12 ). Semua strain dianalisis dalam percobaan REP-PCR yang sama dan pada gel yang sama untuk meminimalkan kemungkinan variasi dalam pola-pola yang disebabkan oleh eksperimen ( 12 ). A REP-PCR pattern could not be obtained for strain MB 359. Pola REP-PCR tidak dapat diperoleh untuk strain 359 MB.
Banding pattern data analyses. Banding pola analisis data.
Digitized images of the gel obtained with the RiboPrinter were converted with the GelConvert program (Qualicon) and were analyzed by the unweighted pair group arithmetic (UPGMA) clustering algorithm computed by the GelCompar software (version 4.1; Applied Maths, Sint-Martens-Latem, Belgium) by using the Pearson product moment correlation coefficient with optimization of 1%. gambar revi dari gel diperoleh dengan RiboPrinter dikonversi dengan program GelConvert (Qualicon) dan dianalisis oleh kelompok aritmatika pasangan tertimbang (UPGMA) clustering algoritma dihitung oleh perangkat lunak GelCompar (versi 4.1; Terapan Matematika, Sint-Martens-Latem, Belgia) dengan menggunakan produk saat koefisien korelasi Pearson dengan optimasi dari 1%. REP-PCR patterns on the silver-stained gels were scanned with a flat-bed scanner (Agfa SnapScan1236 S ; Agfa-Gevaert NV, Mortsel, Belgium), and images were analyzed by UPGMA clustering computed by BioNumerics software (version 2.0; Applied Maths) by using the Pearson product moment correlation coefficient with optimization of 1%. REP-PCR pola pada bernoda gel perak telah discan dengan scanner flat tempat tidur (Agfa SnapScan1236 S; Agfa-Gevaert NV, Mortsel, Belgia), dan gambar dianalisis dengan clustering UPGMA dihitung oleh perangkat lunak BioNumerics (versi 2.0; Matematika Terapan ) dengan menggunakan produk saat koefisien korelasi Pearson dengan optimasi dari 1%. Normalized REP-patterns were also visually classified in REP groups. REP-pola normalisasi juga visual diklasifikasikan dalam kelompok REP.
Combined clustering of the two ribopatterns and the REP-PCR profiles was performed by using the BioNumerics 2.0 software. Gabungan clustering dari dua ribopatterns dan profil REP-PCR dilakukan dengan menggunakan perangkat lunak BioNumerics 2,0. To do this, the converted ribopatterns obtained with Eco RI or Pvu II were introduced into the BioNumerics 2.0 program, and each pattern was linked with the strain database. Untuk melakukan ini, ribopatterns dikonversi diperoleh dengan Eco RI atau Pvu II diperkenalkan ke dalam program 2,0 BioNumerics, dan pola masing-masing dihubungkan dengan database strain. Combination of the three experiment types was implemented in such a way that the typing methods used (REP-PCR, Eco RI riboprinting, and Pvu II riboprinting) were weighted 2:1:1. Kombinasi dari tiga jenis percobaan dilaksanakan sedemikian rupa sehingga metode mengetik yang digunakan (REP-PCR, Eco RI riboprinting, dan Pvu riboprinting II) 02:01:01 tertimbang. For UPGMA clustering for this combination of experiment types, the same cluster analysis settings that were used for each experiment type separately were used (ie, Pearson product moment correlation coefficient). Untuk UPGMA clustering untuk kombinasi jenis percobaan, analisis pengaturan yang sama cluster yang digunakan untuk setiap jenis percobaan digunakan secara terpisah (misalnya, produk saat koefisien korelasi Pearson). Finally, multidimensional scaling of the combined cluster analysis allowed visually interpretable grouping of the strains in a three-dimensional plot. Akhirnya, skala multidimensi analisis cluster gabungan diperbolehkan diinterpretasi secara visual pengelompokan strain dalam rencana tiga-dimensi.
• OTHER SECTIONS▼ BAGIAN LAINNYA ▼
O ABSTRACT ABSTRAK
O MATERIALS AND METHODS BAHAN DAN METODE
O RESULTS HASIL
O DISCUSSION DISKUSI
O REFERENCES DAFTAR PUSTAKA
RESULTS HASIL
Identification. Identifikasi.
Fourteen new isolates of B. Empat belas isolat baru B. sporothermodurans were obtained in this study from contaminated UHT-treated or sterilized consumer milk (designated UHT isolates) from the Dominican Republic, Ecuador, Pakistan, and Mexico. sporothermodurans diperoleh dalam penelitian ini dari terkontaminasi UHT-diperlakukan atau disterilkan konsumen susu (UHT ditunjuk isolat) dari Republik Dominika, Ekuador, Pakistan, dan Meksiko. These strains reacted positively as determined by the two PCR-based methods used for identification of B. Strain ini bereaksi positif sebagaimana ditentukan oleh kedua-berdasarkan metode PCR yang digunakan untuk identifikasi B. sporothermodurans (Table 1 ), the HRS-PCR developed by Herman et al. sporothermodurans (Tabel 1 ), HRS-PCR yang dikembangkan oleh Herman et al. ( 13 ) and the recently developed PCR based on specific 16S rDNA sequence stretches described by Scheldeman et al. ( 13 ) dan PCR baru-baru ini dikembangkan berdasarkan urutan 16S spesifik rDNA peregangan yang dijelaskan oleh Scheldeman et al. ( 22 ). ( 22 ). The reaction pattern was similar to that for the 11 European isolates from UHT-treated and sterilized milk listed in Table 1 and reported by Scheldeman et al. Pola reaksi ini mirip dengan Eropa untuk 11 isolat dari UHT-diperlakukan dan susu disterilkan tercantum pada Tabel 1 dan dilaporkan oleh Scheldeman et al. ( 22 ). ( 22 ). However, in the previous study, it was found that 11 of the 13 isolates from raw milk or animal feed (feed concentrate, soy, silage) (designated farm isolates) (Table 1 ) reacted negatively in the HRS-PCR and positively in the 16S rDNA-based PCR; only two farm strains included in the present study (MB 1501 and MB 1505) reacted positively in both PCR tests (Table 1 ). Namun, dalam studi sebelumnya, ditemukan bahwa 11 dari 13 isolat dari susu mentah atau pakan ternak (pakan konsentrat, kedelai, silase) (ditunjuk pertanian isolat) (Tabel 1 ) bereaksi negatif dalam HRS-PCR dan positif dalam 16S berbasis PCR rDNA; hanya dua jenis peternakan yang termasuk dalam studi ini (MB 1501 dan 1505 MB) bereaksi positif dalam kedua tes PCR (Tabel 1 ).
Ribotyping. Ribotyping.
Molecular characterization of B. Karakterisasi molekuler B. sporothermodurans strains and the B. sporothermodurans strain dan B. oleronius reference strain was performed by automated ribotyping by using the restriction enzymes Pvu II and Eco RI. strain referensi oleronius dilakukan oleh ribotyping otomatis dengan menggunakan enzim restriksi Pvu II dan Eco RI. Sixteen distinct major ribogroups were determined with Pvu II (ribogroups A1 to A16) (Table 1 and Fig. Fig.1). 1 Enam belas ribogroups utama yang berbeda ditentukan dengan Pvu II (ribogroups A1 A16) (Tabel 1 dan Gambar. Gambar 1). 1 ). ). The three largest ribogroups, ribogroups A1, A5, and A13, contained 21, 2, and 2 strains, respectively (Tables 1 and 2 ), whereas the other 13 ribogroups were each represented by a single strain. Tiga ribogroups terbesar, ribogroups A1, A5, dan A13, berisi 21, 2, dan 2 strain, masing-masing (Tabel 1 dan 2 ), sedangkan 13 lainnya ribogroups masing-masing diwakili oleh strain tunggal. Based on the cluster analysis performed with the ribopatterns of 39 strains (including B. sporothermodurans type strain MB 581 and the reference strain of B. oleronius ), a dendrogram was constructed (Fig. (Fig.1). 1 Berdasarkan analisis cluster dilakukan dengan ribopatterns 39 strain (termasuk jenis strain B. sporothermodurans 581 MB dan strain referensi dari oleronius B.), dendrogram ini dibuat (Gbr. (Gambar 1). 1 ). ). Two main clusters, clusters P1 and P2, were discerned visually and by cluster analysis at similarity levels of 91 and 71%, respectively. Dua kelompok utama, kelompok P1 dan P2, yang dibedakan secara visual dan analisis cluster pada tingkat kesamaan 91 dan 71%, masing-masing. These two clusters exhibited 58% similarity to each other. Kedua kelompok menunjukkan 58% kemiripan satu sama lain. The majority of the UHT isolates (21 of 25 isolates) were found in cluster P1, which included one ribogroup. Mayoritas UHT isolat (21 dari 25 isolat) ditemukan di cluster P1, termasuk satu ribogroup. These UHT isolates appeared to be closely related to each other, as reflected by the high similarity values (91 to 99%). UHT isolat ini tampaknya berkaitan erat satu sama lain, seperti yang tercermin oleh nilai-nilai kesamaan yang tinggi (91 sampai 99%). All these isolates produced a typical pattern consisting of at least seven conserved bands at ca. Semua isolat menghasilkan pola khas yang terdiri dari setidaknya tujuh band dilestarikan di ca. 7.2, 8.3, 9.3, 11.0, 13.0, 25.0, and 45.0 kbp. 7.2, 8.3, 9.3, 11,0, 13,0, 25,0, dan 45,0 KBP. In cluster P2, which was defined at a lower similarity level (71%), 14 different ribogroups were found; there were typical bands at ca. Dalam P2 cluster, yang didefinisikan pada tingkat kesamaan yang lebih rendah (71%), 14 ribogroups berbeda ditemukan; ada band khas di ca. 5.4, 7.1, 7.5, 8.5, 9.0, 11.0, and 25.0 kbp in the patterns of most of the strains, while 13.0- and 45.0-kbp fragments were missing compared to the patterns of cluster P1 strains. 5.4, 7.1, 7.5, 8.5, 9.0, 11,0, dan 25,0 KBP dalam pola sebagian besar strain, sementara 13,0 dan 45,0-KBP fragmen yang hilang dibandingkan dengan pola cluster strain P1. Remarkably, UHT strains MB 372, MB 373, and MB 374, all of which originated from Germany, had clearly distinct patterns and were members of cluster P2 along with all 13 farm isolates. Hebatnya, strain UHT 372 MB, 373 MB, dan 374 MB, yang semuanya berasal dari Jerman, memiliki pola yang jelas berbeda dan anggota P2 cluster bersama dengan semua 13 isolat pertanian. Type strain MB 581 was located separately between clusters P1 and P2. 581 MB jenis strain terletak secara terpisah antara kelompok P1 dan P2.


FIG. FIG. 1. 1.
Dendrogram of 38 strains of B. Dendrogram dari 38 strain B. sporothermodurans and one strain of B. sporothermodurans dan satu strain B. oleronius obtained after restriction with Pvu II. oleronius diperoleh setelah restriksi Pvu II. The strain designations correspond to those shown in Table 1 . Regangan sebutan sesuai dengan yang ditunjukkan pada Tabel 1 . The scale bar indicates the percentage of similarity. Skala bar menunjukkan persentase kesamaan.

TABLE 2. TABEL 2.
Relationships between the different most important Pvu II and Eco RI ribogroups a Hubungan antara penting Pvu II paling berbeda dan RI Eco sebuah ribogroups
With Eco RI, 20 distinct ribogroups were found, and these ribogroups were designated ribogroups B1 to B20 (Table 1 and Fig. Fig.2). 2 Dengan Eco RI, 20 ribogroups berbeda ditemukan, dan ini adalah yang ditunjuk ribogroups ribogroups B1 menjadi B20 (Tabel 1 dan Gambar. Gbr.2). 2 ). ). Ribogroups B1 and B3 each contained nine strains, while two strains belonged to ribogroups B9 and B17. Ribogroups B1 dan B3 masing-masing berisi sembilan strain, sementara dua strain milik ribogroups B9 dan B17. Sixteen ribogroups were represented by a single strain. Enam belas ribogroups diwakili oleh strain tunggal. All 38 strains of B. Semua 38 strain B. sporothermodurans produced at least five typical conserved bands, at ca. sporothermodurans memproduksi paling sedikit lima band dilestarikan khas, di ca. 2.2, 2.9, 3.8, 7.0, and 8.3 kbp. 2,2, 2,9, 3,8, 7,0, dan 8,3 KBP. The dendrogram constructed with the Eco RI-generated patterns showed high degrees of similarity (ca. 80% without strain MB 582) among the B. The dendrogram dibangun dengan pola yang dihasilkan RI-Eco menunjukkan kesamaan derajat tinggi (sekitar 80% tanpa regangan 582 MB) di antara B. sporothermodurans strains (Fig. (Fig.2). 2 sporothermodurans strain (Gbr. (Gbr.2). 2 ). ). Despite the lower diversity, two main clusters, designated clusters E1 and E2, were discerned visually and by cluster analysis at similarity levels of 81 and 86%, respectively. Meskipun keragaman lebih rendah, dua kelompok utama, ditunjuk cluster E1 dan E2, yang dibedakan secara visual dan analisis cluster pada tingkat kesamaan 81 dan 86%, masing-masing. Interestingly, cluster E1 encompassed 24 UHT isolates but did not contain UHT strain MB 582, whereas cluster E2 contained all 13 farm isolates. Menariknya, mencakup 24 cluster E1 UHT isolat tetapi tidak mengandung strain UHT 582 MB, sedangkan E2 cluster berisi semua 13 isolat pertanian. Compared to the ribopatterns of the UHT isolates, most of the ribopatterns in cluster E2 showed polymorphisms in the region between 4.0 and 6.0 kbp, and one or two extra bands were present. Dibandingkan dengan ribopatterns dari UHT isolat, sebagian besar ribopatterns di E2 cluster menunjukkan polimorfisme di wilayah antara 4,0 dan 6,0 KBP, dan satu atau dua band ekstra hadir. The farm isolates were scattered in 11 distinct ribogroups, confirming the genetic variability observed with the Pvu II-generated patterns. Pertanian isolat tersebar di 11 ribogroups berbeda, yang menyatakan variabilitas genetik diamati dengan pola yang dihasilkan II Pvu. UHT strain MB 582 (= TP1248) formed a separate ribogroup, ribogroup B19. UHT strain 582 MB (= TP1248) membentuk ribogroup terpisah, ribogroup B19. This result is in agreement with the previous finding of Pettersson et al. Hasil ini sesuai dengan temuan sebelumnya et al Pettersson. ( 20 ), who described strain TP1248 as a strain that is slightly atypical based on ribotyping analysis. ( 20 ), yang dijelaskan strain TP1248 sebagai strain yang sedikit atipikal berdasarkan analisis ribotyping.


FIG. FIG. 2. 2.
Dendrogram of 38 strains of B. Dendrogram dari 38 strain B. sporothermodurans and one strain of B. sporothermodurans dan satu strain B. oleronius obtained after restriction with Eco RI. oleronius diperoleh setelah restriksi Eco RI. The strain designations correspond to those shown in Table 1 . Regangan sebutan sesuai dengan yang ditunjukkan pada Tabel 1 . The scale bar indicates the percentage of similarity. Skala bar menunjukkan persentase kesamaan.
As illustrated in Table 2 , the combination of restriction enzymes Pvu II and Eco RI enabled a finer level of discrimination, as illustrated for strains MB 1497 and MB 1501. Seperti yang digambarkan dalam Tabel 2 , kombinasi pembatasan enzim Pvu II dan Eco RI diaktifkan tingkat diskriminasi yang lebih baik, seperti yang digambarkan untuk strain MB MB 1497 dan 1501. These strains, which constituted a single ribogroup (ribogroup A5) when Pvu II was used, could be differentiated from each other with Eco RI (ribogroups B20 and B17). Strain ini, yang merupakan sebuah ribogroup tunggal (ribogroup A5) ketika Pvu II digunakan, dapat dibedakan satu sama lain dengan Eco RI (ribogroups B20 dan B17). Conversely, strains MB 1317 and MB 1494, which were indistinguishable on the basis of typing with Eco RI (ribogroup B9), could be discriminated with Pvu II (ribogroups A10 and A8). Sebaliknya, strain dan MB 1317 MB 1494, yang dibedakan berdasarkan mengetik dengan Eco RI (B9 ribogroup), dapat dibedakan dengan Pvu II (ribogroups A10 dan A8). Also, strain TP1248 could be separated from all other strains only when Eco RI was used. Selain itu, strain TP1248 dapat dipisahkan dari semua jenis lainnya hanya ketika Eco RI digunakan. All the Pvu II ribogroups could be further differentiated with Eco RI and vice versa. Semua Pvu II ribogroups lebih lanjut bisa dibedakan dengan Eco RI dan sebaliknya. However, the relationship between different Pvu II and Eco RI ribogroups in some instances was rather complex. Namun, hubungan antara II Pvu berbeda dan Eco RI ribogroups dalam beberapa kasus agak rumit.
B. oleronius MB 397 was ribotyped as an outlier. oleronius B. 397 MB adalah ribotyped sebagai suatu outlier. The Pvu II- or Eco RI-generated ribopatterns of B. The Pvu II-atau Eco RI-dihasilkan ribopatterns B. oleronius MB 397 were clearly different from those obtained with all the B. oleronius 397 MB itu jelas berbeda dari yang diperoleh dengan semua B. sporothermodurans strains (similarity levels, 40 and 57%, respectively). strain sporothermodurans (tingkat kesamaan, 40 dan 57%, masing-masing).
REP-PCR. REP-PCR.
Molecular characterization of B. Karakterisasi molekuler B. sporothermodurans strains and the B. sporothermodurans strain dan B. oleronius reference strain was performed by REP-PCR by using high-resolution separation of the bands by polyacrylamide gel electrophoresis and silver staining. strain referensi oleronius dilakukan oleh REP-PCR dengan menggunakan resolusi tinggi pemisahan dari band-band dengan elektroforesis gel poliakrilamida dan pewarnaan perak. Fourteen distinct major REP groups were visually determined (REP groups C1 to C14) (Table 1 and Fig. Fig.3). 3 Empat belas REP berbeda besar kelompok visual ditentukan (REP kelompok C1 untuk C14) (Tabel 1 dan Gambar. Gbr.3). 3 ). ). The two largest REP groups, REP groups C1 and C2, contained 3 and 22 strains, respectively (Table 1 ), whereas the other 12 REP groups were each represented by a single strain. Dua kelompok terbesar REP, REP kelompok C1 dan C2, berisi 3 dan 22 strain, masing-masing (Tabel 1 ), sedangkan kelompok 12 REP lainnya masing-masing diwakili oleh strain tunggal. In comparison with B. Dibandingkan dengan B. oleronius , all B. oleronius, semua B. sporothermodurans strains were characterized by a conserved major band at ca. sporothermodurans strain dikarakterisasi oleh sebuah band besar kekal di ca. 1,020 bp. 1.020 pb. Furthermore, strains belonging to REP groups C1 and C2, which contained all UHT isolates and only one farm isolate (MB 1505), were characterized by major conserved bands at ca. Selain itu, strain milik kelompok REP C1 dan C2, yang berisi UHT semua isolat dan hanya satu peternakan isolat (MB 1505), yang ditandai dengan band dilestarikan besar di ca. 875, 730, and 600 bp. 875, 730, dan 600 bp. Remarkably, the German UHT strains, MB 372 to MB 374, belonged to the same REP group, REP group C1, which could be differentiated from REP group C2, which contained the other UHT strains from different countries, by the absence of a major conserved band at ca. Hebatnya, alunan UHT Jerman, MB 374 MB 372 untuk, milik kelompok REP sama, REP kelompok C1, yang bisa dibedakan dari kelompok C2 REP, yang berisi jenis UHT lainnya dari berbagai negara, dengan tidak adanya utama kekal band di ca. 850 bp in REP group C2. 850 pb di grup C2 REP. The largest REP group (REP group C2) could be further subdivided into four subgroups on the basis of minor polymorphisms (presence or absence of minor bands at various molecular weights). REP kelompok terbesar (REP C2 kelompok) yang bisa lebih jauh dibagi menjadi empat kelompok berdasarkan polimorfisme minor (ada atau tidak adanya band kecil di berbagai berat molekul). These four subgroups, subgroups C2a to C2d (Table 1 and Fig. Fig.3), 3 Keempat subkelompok, subkelompok C2a untuk C2d (Tabel 1 dan Gambar. Gbr.3), 3 ), contained 8, 2, 2, and 10 strains, respectively. ), Berisi 8, 2, 2, dan 10 strain, masing-masing.


FIG. FIG. 3. 3.
Dendrogram of 37 strains of B. Dendrogram dari 37 strain B. sporothermodurans and one strain of B. sporothermodurans dan satu strain B. oleronius obtained by REP-PCR. oleronius diperoleh oleh REP-PCR. The strain and REP group designations correspond to those shown in Table 1 . Ketegangan dan sebutan kelompok REP sesuai dengan yang ditunjukkan pada Tabel 1 . The scale bar indicates the percentage of similarity as determined with the (more ...) Skala bar menunjukkan persentase yang ditentukan kesamaan dengan (more ...)

By performing a cluster analysis of the REP patterns, a dendrogram was constructed (Fig. (Fig.3). 3 Dengan melakukan analisis cluster dari pola REP, dendrogram ini dibuat (Gbr. (Gbr.3). 3 ). ). All of the B. Semua B. sporothermodurans strains showed an overall similarity level of only 50%, indicating great genetic diversity. sporothermodurans strain menunjukkan tingkat kesamaan keseluruhan hanya 50%, yang menunjukkan keanekaragaman genetik yang besar. Only one major cluster, cluster R1, could be discerned visually and by cluster analysis at a meaningful similarity level (80%). Hanya satu cluster besar, cluster R1, dapat dibedakan secara visual dan analisis cluster pada tingkat kesamaan yang berarti (80%). All the UHT isolates were found in this major cluster, which contained REP groups C1 and C2. Semua UHT isolat ditemukan dalam cluster besar, yang berisi kelompok REP C1 dan C2. With the exception of two strains (MB 1494 and MB 1497) which exhibited 84% similarity to each other, the farm strains exhibited less than 80% similarity to each other and to the major cluster R1 strains. Dengan pengecualian dari dua strain (MB MB 1494 dan 1497) yang menunjukkan 84% kemiripan satu sama lain, kesamaan strain peternakan dipamerkan kurang dari 80% satu sama lain dan untuk cluster besar R1 strain. The closest relatives of cluster R1 of UHT isolates based on their REP patterns were farm strains MB 385 (isolated from raw milk) and MB 1317 (isolated from feed concentrate), at a similarity level of 76%. Para kerabat terdekat dari cluster R1 dari UHT isolat berdasarkan pola mereka REP adalah peternakan strain 385 MB (terisolasi dari susu mentah) dan MB 1317 (terisolasi dari konsentrat pakan), pada tingkat kesamaan 76%. Surprisingly, farm strain MB 1505 belonging to REP group C2b (Table 1 ) clustered at only 69% similarity with cluster R1 containing the other REP group C2 strains. Anehnya, peternakan strain 1505 MB milik kelompok REP C2b (Tabel 1 ) bergerombol di hanya 69% kemiripan dengan cluster R1 berisi C2 REP jenis kelompok lain. This can probably be explained by differences in band intensity, such as a less intense major band at ca. Ini mungkin dapat dijelaskan oleh perbedaan dalam intensitas band, seperti band besar kurang intens di ca. 1,020 bp in the pattern of MB 1505 (Fig. (Fig.3), 3 1020 pb dalam pola MB 1505 (Gambar (Gbr.3), 3 ), which is known to influence clustering by the Pearson correlation coefficient ( 25 ). ), Yang dikenal untuk mempengaruhi clustering oleh koefisien korelasi Pearson ( 25 ).
The REP pattern of B. The REP pola B. oleronius reference strain MB 397 was clearly different from the main B. oleronius 397 MB strain referensi jelas berbeda dari B. utama sporothermodurans pattern. sporothermodurans pola.
Combined analysis of ribotyping and REP-PCR patterns. Gabungan analisis-PCR ribotyping dan pola REP.
The overall or consensus genetic relatedness among the B. Atau konsensus genetik secara keseluruhan keterkaitan antara B. sporothermodurans strains was inferred from a combined numerical analysis of the ribopatterns obtained with Pvu II and Eco RI and the REP-PCR patterns by performing a UPGMA cluster analysis and by three-dimensional scaling. sporothermodurans strain diduga dari analisis numerik gabungan dari ribopatterns diperoleh dengan Pvu II dan Eco RI dan pola REP-PCR dengan melakukan analisis cluster UPGMA dan scaling tiga dimensi. In the cluster analysis (data not shown), 21 of the 24 UHT strains included clustered together at a minimal similarity level of 81%. Dalam analisis cluster (data tidak ditampilkan), 21 dari 24 strain UHT termasuk berkumpul bersama di tingkat kesamaan minimal 81%. In this cluster, 19 UHT strains clustered together at 86% similarity, with strain MB 582 and type strain MB 581 joining at 84 and 81%, respectively. Dalam cluster ini, strain UHT 19 berkumpul bersama pada kesamaan 86%, dengan strain 582 MB dan 581 MB jenis strain bergabung di 84 dan 81%, masing-masing. Conversely, 10 of the 13 farm strains and the three German UHT strains (MB 372 to MB 374) produced a cluster at a lower level of similarity (70%), exhibiting only 67% similarity to the major cluster of UHT strains. Sebaliknya, 10 dari 13 strain peternakan dan tiga strain UHT Jerman (372 MB ke 374 MB) diproduksi cluster di tingkat yang lebih rendah dari kesamaan (70%), menunjukkan hanya 67% kesamaan terhadap cluster utama dari strain UHT. The remaining three farm strains (MB 1316, MB 1495, and MB 1499) clustered together at 76% similarity and exhibited a lower level of similarity (64%) to all other B. Pertanian strain tiga sisa (MB 1316, MB 1495, dan 1499 MB) berkumpul bersama di% kemiripan 76 dan menunjukkan tingkat yang lebih rendah dari kesamaan (64%) untuk semua B. lain sporothermodurans strains. sporothermodurans strain.
The results of the combined analysis of the data by three-dimensional scaling are shown in Fig. Fig.4. 4 Hasil analisis gabungan dari data dengan skala tiga dimensi yang ditunjukkan pada Gambar. Gbr.4. 4 . . In this nonhierarchical presentation of the relationships among the strains, essentially the same groups were obtained as in the hierarchical cluster analysis explained above. Dalam presentasi ini nonhierarchical dari hubungan antara strain, pada dasarnya kelompok yang sama diperoleh seperti dalam analisis cluster hirarkis dijelaskan di atas. All UHT strains except the three German UHT strains formed a compact group, while all farm strains formed a very diffuse group clearly separated from the group of UHT strains. strain UHT Semua kecuali tiga jenis UHT Jerman membentuk sebuah kelompok yang kompak, sementara semua jenis peternakan membentuk sebuah kelompok yang sangat menyebar jelas terpisah dari kelompok strain UHT. The only remarkable difference from the UPGMA cluster analysis was the grouping of the three German UHT isolates at the outer edge of the diffuse group of farm strains, showing a somewhat closer relationship to the other UHT isolates. Satu-satunya perbedaan yang luar biasa dari analisis cluster UPGMA adalah pengelompokan dari Jerman UHT tiga isolat di tepi luar kelompok strain peternakan baur, menunjukkan hubungan yang agak dekat dengan isolat UHT lainnya.



FIG. FIG. 4. 4.
Visual three-dimensional representation of the combined clustering of the two ribotyping patterns ( Eco RI and Pvu II) and REP-PCR profiles of 37 strains of B. Visual tiga dimensi representasi dari pengelompokan gabungan dari dua pola ribotyping (Eco RI dan Pvu II) dan REP-PCR profil dari 37 strain B. sporothermodurans and one strain of B. sporothermodurans dan satu strain B. oleronius , obtained by multidimensional scaling of the (more ...) oleronius, diperoleh skala multidimensi dari (more ...)

• OTHER SECTIONS▼ BAGIAN LAINNYA ▼
O ABSTRACT ABSTRAK
O MATERIALS AND METHODS BAHAN DAN METODE
O RESULTS HASIL
O DISCUSSION DISKUSI
O REFERENCES DAFTAR PUSTAKA
DISCUSSION DISKUSI
In this study, European isolates of B. Dalam studi ini, Eropa isolat B. sporothermodurans from UHT-treated and sterilized milk and isolates obtained from a large screening analysis of heat-resistant sporeformers from the farm environment (raw milk, feed concentrate, silage), as well as new non-European isolates from UHT-treated and sterilized milk, were characterized at different molecular levels. sporothermodurans dari UHT-diperlakukan dan disterilkan susu dan isolat yang diperoleh dari analisis penyaringan besar-sporeformers tahan panas dari lingkungan peternakan (susu mentah, konsentrat pakan, silase), serta baru non-Eropa isolat dari UHT-diperlakukan dan disterilkan susu , dikarakterisasi pada tingkat molekul yang berbeda. The new UHT isolates were obtained from different continents and countries (Mexico, Ecuador, Dominican Republic, Pakistan) and were found to be positive by both the HRS-PCR ( 13 ) and the general B. The UHT baru isolat diperoleh dari berbagai benua dan negara (Meksiko, Ekuador, Republik Dominika, Pakistan) dan ditemukan untuk menjadi positif oleh HRS-PCR ( 13 ) dan B. umum sporothermodurans -specific PCR ( 22 ). sporothermodurans khusus PCR ( 22 ). In contrast, the majority of the farm isolates reacted negatively in the HRS-PCR ( 22 ). Sebaliknya, sebagian besar peternakan isolat bereaksi negatif di HRS-PCR ( 22 ). This result confirms that the HRS-PCR is more discriminatory for the B. Hasil ini menegaskan bahwa HRS-PCR lebih diskriminatif untuk B. sporothermodurans strains which are relevant for UHT-treated products. sporothermodurans strain yang relevan untuk diperlakukan-produk UHT.
In a polyphasic typing approach, separate clustering analyses of Pvu II and Eco RI ribopatterns and of REP-PCR patterns were largely consistent with each other and revealed the existence of two main clusters; one homogeneous group contained all (REP-PCR) or most (ribotyping) of the UHT isolates, and the second, more diverse group comprised the farm isolates (Fig. (Fig.1 1 Dalam pendekatan mengetik polyphasic, analisis clustering terpisah Pvu II dan Eco RI ribopatterns dan pola REP-PCR sebagian besar konsisten satu sama lain dan mengungkapkan adanya dua kelompok utama; satu kelompok homogen berisi semua (REP-PCR) dan paling ( ribotyping) dari UHT isolat, dan yang kedua, kelompok yang lebih beragam terdiri peternakan isolat (Gbr. (Gambar 1 1 to to3). 3 untuk to3). 3 ). ). The high level of genetic homology of most of the UHT isolates was further shown by a combined analysis of all molecular typing data in this study, both by cluster analysis and by three-dimensional scaling, which revealed a very compact cluster or group of isolates. Tingkat tinggi homologi genetik dari kebanyakan isolat UHT semakin ditunjukkan oleh analisis gabungan dari semua data mengetik molekuler dalam penelitian ini, baik dengan analisis cluster dan dengan skala tiga-dimensi, yang mengungkapkan cluster sangat kompak atau kelompok isolat. The close genetic relationship of the UHT isolates suggests a clonal origin (HRS clone), which is particularly remarkable since B. Hubungan genetik dekat UHT isolat menunjukkan sumber berasal dari klon (HRS clone), yang sangat luar biasa karena B. sporothermodurans strains were isolated from UHT-treated and sterilized milk samples produced on three different continents. sporothermodurans strain diisolasi dari UHT-diperlakukan dan disterilkan sampel susu yang diproduksi di tiga benua yang berbeda.
The three German isolates were the only UHT strains whose genetic characteristics were quite different from those of the majority of the UHT strains. Isolat tiga Jerman adalah strain UHT hanya karakteristik genetik yang cukup berbeda dengan mayoritas strain UHT. In a combined cluster analysis of all molecular typing data obtained in this study, the three German UHT strains clustered with the farm strains. Dalam analisis cluster gabungan semua data mengetik molekul yang diperoleh dalam penelitian ini, tiga strain UHT Jerman bergerombol dengan strain pertanian. A three-dimensional scaling analysis of all molecular typing data showed that these strains were at the border of the diffuse group of farm strains and directed to the compact group of UHT isolates. Analisis skala tiga-dimensi dari semua data mengetik molekuler menunjukkan bahwa strain ini berada di perbatasan kelompok baur strain pertanian dan diarahkan untuk kelompok kompak UHT isolat. The latter observation and the REP-PCR and Eco RI ribotyping cluster analysis data suggest that the German UHT isolates have a remote genetic relationship with the HRS clone. Pengamatan terakhir ini dan REP-PCR dan Eco RI ribotyping cluster analisis data menunjukkan bahwa isolat UHT Jerman memiliki hubungan genetik jauh dengan klon HRS. This could also suggest that the extreme resistance of spores to sterilization temperatures is restricted to particular clones that have a possible common ancestor. Ini juga bisa menunjukkan bahwa perlawanan ekstrim dari spora untuk sterilisasi suhu dibatasi untuk klon tertentu yang memiliki nenek moyang mungkin.
In contrast to the homogeneity found for the majority of the UHT isolates, the ribopatterns and REP patterns of the B. Berbeda dengan homogenitas yang ditemukan untuk mayoritas UHT isolat, yang ribopatterns dan pola REP dari B. sporothermodurans strains isolated from animal feed (feed concentrate, silage, soy) and raw milk were much more diverse. sporothermodurans strain terisolasi dari pakan ternak (konsentrat pakan, silase, kedelai) dan susu mentah jauh lebih beragam. Most of the ribogroups and all 12 REP types for the farm isolates were represented by a single strain (Table 1 ). Sebagian besar ribogroups dan semua 12 REP jenis untuk peternakan isolat diwakili oleh strain tunggal (Tabel 1 ). Also, the two HRS-PCR-positive farm strains, which originated from feed concentrate and silage, produced patterns that were different from each other and from the patterns of the main group of UHT isolates (HRS clone) in the ribotyping analysis. Juga, kedua jenis peternakan HRS-PCR-positif, yang berasal dari konsentrat pakan dan silase, menghasilkan pola-pola yang berbeda satu sama lain dan dari pola kelompok utama UHT isolat (HRS clone) dalam analisis ribotyping. Overall, it seems that there is no 100% concordance between a positive result in the HRS-PCR analysis and an HRS clone pattern determined by molecular typing. Secara keseluruhan, tampaknya tidak ada konkordansi 100% antara hasil positif dalam analisis HRS-PCR dan kloning pola HRS ditentukan dengan mengetik molekul.
Milk powder has been suggested to be a possible source of contamination of heat-treated dairy products ( 8 ). Susu bubuk telah diusulkan untuk menjadi sumber kontaminasi yang mungkin diperlakukan produk susu-panas ( 8 ). Since in some plants, UHT-treated or sterilized milk is prepared from imported milk powder, this practice could explain the spread of the same B. Sejak di beberapa tanaman, UHT-diperlakukan atau disterilkan susu dibuat dari susu bubuk impor, praktek ini bisa menjelaskan penyebaran B. sama sporothermodurans HRS clone over different continents. sporothermodurans HRS klon atas benua yang berbeda. Within one country, one can envisage a contamination route via raw milk that has been contaminated through animal feed at the farm level. Dalam satu negara, kita dapat membayangkan rute kontaminasi melalui susu mentah yang telah tercemar melalui pakan ternak di tingkat petani. Based on this assumption, one would expect to find B. Berdasarkan asumsi ini, orang akan berharap untuk menemukan B. sporothermodurans strains having similar ribopatterns or REP-PCR patterns in animal feed or raw milk, as well as in UHT-treated or sterilized milk. sporothermodurans strain memiliki ribopatterns serupa atau pola REP-PCR dalam pakan hewan atau susu mentah, serta di-UHT susu dirawat atau disterilkan. However, the combined analysis of all typing data definitely showed that none of the farm isolates genetically resembled any of the UHT isolates. Namun, analisis gabungan semua data mengetik pasti menunjukkan bahwa tidak ada peternakan genetik isolat menyerupai apapun UHT isolat. Since all farm isolates in this study originated from Belgium, they probably represent only a limited part of the natural genetic diversity of B. Sejak pertanian semua isolat dalam penelitian ini berasal dari Belgia, mereka mungkin hanya mewakili bagian terbatas dari keragaman genetik alam B. sporothermodurans . sporothermodurans. The data presented here confirm the hypothesis that the regular occurrence of contaminated UHT-treated and sterilized milk in some European dairy plants in the mid-1990s, as well as the present sporadic occurrence of contamination, can also be caused by circulation of the HRS clone within and between UHT production units. Data yang disajikan di sini mengkonfirmasi hipotesis bahwa terjadinya reguler terkontaminasi UHT-diperlakukan dan disterilkan susu di beberapa pabrik susu Eropa pada pertengahan 1990-an, serta terjadinya kontaminasi sporadis ini, juga dapat disebabkan oleh sirkulasi dari klon HRS dalam dan di antara unit produksi UHT. Occasionally, contamination of UHT-treated milk by a new genetic type (eg, a type originating at the farm level) occurs, as exemplified here by the German UHT isolates. Kadang-kadang, kontaminasi susu UHT-diperlakukan dengan jenis genetik baru (misalnya, jenis yang berasal di tingkat petani) terjadi, seperti yang tampak di sini oleh UHT Jerman isolat. At present, the data obtained in this study do not favor or eliminate any of the potential contamination routes mentioned above. Saat ini, data yang diperoleh dalam studi ini tidak mendukung atau menghilangkan salah satu rute potensial kontaminasi disebutkan di atas.
In conclusion, this molecular typing study showed that a few clones of B. Sebagai kesimpulan, penelitian ini menunjukkan bahwa molekul mengetik beberapa klon B. sporothermodurans , including the so-called HRS clone, have been and are still responsible for the contamination of UHT-treated and sterilized milk and milk products due to the production of highly heat-resistant spores. sporothermodurans, termasuk yang disebut HRS klon-jadi, telah dan masih bertanggung jawab atas kontaminasi UHT-diperlakukan dan disterilkan susu dan produk susu karena produksi spora tahan panas tinggi. In particular, the HRS clone has spread over several European countries and even between continents. Secara khusus, klon HRS telah tersebar di beberapa negara Eropa dan bahkan antar benua. The strains isolated from UHT-treated and sterilized milk show a close genetic relationship, suggesting a common ancestry for the production of highly heat-resistant spores. Strain terisolasi dari UHT-diperlakukan dan disterilkan susu menunjukkan hubungan genetik dekat, menyarankan nenek moyang yang sama untuk produksi spora yang sangat tahan panas. An intriguing question which emerges, is whether the capacity to produce highly heat-resistant spores that allow survival after certain heat treatments is restricted to the subgroup of UHT isolates or whether it is a property more widespread in B sporothermodurnans , including the farm isolates. Sebuah pertanyaan menarik yang muncul, adalah apakah kapasitas untuk memproduksi spora tahan panas tinggi yang memungkinkan kelangsungan hidup setelah perlakuan panas tertentu terbatas pada subkelompok UHT isolat atau apakah itu adalah properti lebih luas di sporothermodurnans B, termasuk peternakan isolat. Although heat resistance is not an absolute spore property and is influenced by several factors, such as repeated laboratory cultivation ( 16 ), preliminary studies indicate that some farm isolates produce spores with remarkably high heat resistance. Meskipun ketahanan panas bukan properti spora mutlak dan dipengaruhi oleh beberapa faktor, seperti budidaya laboratorium ulang ( 16 ), penelitian pendahuluan menunjukkan bahwa pertanian beberapa isolat menghasilkan spora dengan panas perlawanan sangat tinggi. However, it remains to be determined whether these spores can also survive UHT treatment (O. Guillaume-Gentil, P. Keijzer, P. Scheldeman, and M. Heyndrickx, unpublished data). Namun, masih harus ditentukan apakah spora ini juga dapat bertahan hidup pengobatan UHT (O. Guillaume-Gentil, P. Keijzer, P. Scheldeman, dan M. Heyndrickx, data tidak dipublikasikan). The molecular typing techniques used in this study demonstrated the great genetic heterogeneity of B. Teknik molekular mengetik yang digunakan dalam penelitian ini menunjukkan heterogenitas genetik yang besar B. sporothermodurans isolates from dairy farms, even though they had been isolated in only one country. sporothermodurans isolat dari peternakan sapi perah, meskipun mereka telah diisolasi hanya dalam satu negara. Because of this observed heterogeneity, the original taxonomic description of B. Karena heterogenitas ini diamati, deskripsi taksonomi asli B. sporothermodurans , which was based on only a few genetically homogeneous UHT isolates ( 20 ), may no longer be adequate. sporothermodurans, yang didasarkan pada hanya beberapa homogen UHT genetis isolat ( 20 ), mungkin tidak lagi memadai.
ACKNOWLEDGMENTS UCAPAN TERIMA KASIH
We thank the Belgian Ministry of Small Enterprises, Traders and Agriculture, DG6—Division of Research, for financial support. Kami mengucapkan terima kasih kepada Menteri Belgia Usaha Kecil, Pedagang dan Pertanian, DG6-Divisi Riset, untuk dukungan keuangan.
We thank E. Engels for performing REP-PCR, P. De Vos (University of Ghent, Ghent, Belgium) for the use of the BioNumerics software, and E. Bidlas for determination of ribopatterns. Kami berterima kasih E. Engels untuk melakukan REP-PCR, P. De Vos (University of Ghent, Ghent, Belgia) untuk penggunaan perangkat lunak BioNumerics, dan E. Bidlas untuk penentuan ribopatterns.
• OTHER SECTIONS▼ BAGIAN LAINNYA ▼
O ABSTRACT ABSTRAK
O MATERIALS AND METHODS BAHAN DAN METODE
O RESULTS HASIL
O DISCUSSION DISKUSI
O REFERENCES DAFTAR PUSTAKA
REFERENCES DAFTAR PUSTAKA
1. Anonymous. 1992. 1.. Anonymous 1992. Directive 92/46/EEC. Petunjuk 92/46/EEC. Council of the European Communities of 16 July. Dewan Masyarakat Eropa 16 Juli. Health rules for the production and the trade of raw milk, heat-treated milk, and products based on milk. Kesehatan aturan untuk produksi dan perdagangan susu mentah, yang diobati susu panas, dan produk berbasis susu. Off. Off. J. Eur. J. Eur. Community L268: 1-32. Komunitas L268: 1-32.
2. Bruce, J. 1996. 2. Bruce, J. 1996. Automated system rapidly identifies and characterizes micro-organisms in food. Food Technol. 50 : 77-81. sistem otomatis cepat mengidentifikasi dan mencirikan mikro-organisme dalam makanan Technol. Pangan:. 50 77-81.
3. Dalsgaard, A., P. Echeverria, JL Larsen, R. Siebeling, O. Serichantalergs, and HH Huss. 1995. 3. Dalsgaard, A., P. Echeverria, Larsen JL, R. Siebeling, O. Serichantalergs, dan Huss HH. 1995. Application of ribotyping for differentiating Vibrio cholerae Vibrio cholerae non-O1 isolated from shrimp farms in Thailand. Appl. Aplikasi ribotyping untuk membedakan Vibrio cholerae Vibrio cholerae non-O1 diisolasi dari tambak udang di Thailand. Appl. Environ. Environ. Microbiol. 61 : 245-251. [ PMC free article ] [ PubMed ] Microbiol:. 61 245-251 [. PMC bebas artikel ] [ PubMed ]
4. De Silva, S., B. Pettersson, M. De Muro, and F. Priest. 1998. 4,. De Silva S., B. Pettersson, M. De Muro, dan Imam F.. 1998. A DNA probe for the detection and identification of Bacillus sporothermodurans Bacillus sporothermodurans using the 16S-23S rDNA spacer region and phylogenetic analysis of some field isolates of Bacillus Bacillus which form highly heat resistant spores. Syst. Sebuah probe DNA untuk deteksi dan identifikasi Bacillus Bacillus sporothermodurans sporothermodurans menggunakan rDNA 23S-16S spacer wilayah dan analisis filogenetik lapangan beberapa isolat Bacillus Bacillus yang membentuk spora yang sangat tahan panas. SYST. Appl. Appl. Microbiol. 21 : 388-407. Microbiol:. 21 388-407.
5. Dombek, P., L. Johnson, S. Zimmerley, and M. Sadowsky. 2000. 5,. Dombek P., L. Johnson, S. Zimmerley, dan Sadowsky M.. 2000. Use of repetitive DNA sequences and the PCR to differentiate Escherichia coli Escherichia coli isolates from human and animal sources. Appl. Gunakan urutan DNA repetitif dan PCR untuk membedakan Escherichia coli Escherichia coli isolat dari sumber-sumber manusia dan hewan. Appl. Environ. Environ. Microbiol. 66 : 2572-2577. [ PMC free article ] [ PubMed ] Microbiol:. 66 2572-2577 [. PMC bebas artikel ] [ PubMed ]
6. Foschino, R., A. Galli, and G. Ottogali. 1990. 6,. Foschino R., A. Galli, dan Ottogali. 1990 G.. Research on the microflora of UHT milk. Ann. Penelitian mengenai susu UHT mikroflora. Ann. Microbiol. 40 : 47-59. Microbiol:. 40 47-59.
7. Gendel, SM, and J. Ulaszek. 2000. 7,. Gendel SM, dan Ulaszek. 2000 J.. Ribotype analysis of strain distribution in Listeria monocytogenes Listeria monocytogenes. J. analisis Ribotype strain distribusi di Listeria monocytogenes Listeria monocytogenes. J. Food Prot. 63 : 179-185. [ PubMed ] Makanan Prot:. 63. [179-185 PubMed ]
8. Hammer, P., F. Lembke, G. Suhren, and W. Heeschen. 1995. 8. Hammer, P., F. Lembke, G. Suhren, dan Heeschen W.. 1995. Characterization of a heat resistant mesophilic Bacillus Bacillus species affecting quality of UHT-milk—a preliminary report. Kiel. Karakterisasi panas spesies Bacillus Bacillus mesofilik tahan mempengaruhi kualitas susu-sebuah awal laporan UHT. Kiel. Milchwirtsch. Milchwirtsch. Forschungsber. 47 : 303-311. Forschungsber:. 47 303-311.
9. Hammer, P., G. Suhren, and W. Heeschen. 1995. 9. Hammer, P., G. Suhren, dan Heeschen W.. 1995. Pathogenicity testing of unknown mesophilic heat resistant bacilli from UHT-milk. Bull. Patogenisitas pengujian panas mesofilik diketahui tahan bakteri dari susu UHT-. Bull. Int. Int. Dairy Fed. 302 : 56-57. Susu Fed:. 302 56-57.
10. Herman, L., M. Heyndrickx, M. Vaerewijck, and N. Klijn. 2000. Bacillus sporothermodurans Bacillus sporothermodurans—a Bacillus Bacillus forming highly heat-resistant spores. 10,. Herman L., M. Heyndrickx, M. Vaerewijck, dan N. Klijn. 2000. Sporothermodurans Bacillus Bacillus sporothermodurans-sebuah Bacillus Bacillus membentuk spora tahan panas tinggi. 3. 3. Isolation and methods of detection. Bull. Isolasi dan metode deteksi. Bull. Int. Int. Dairy Fed. 357 : 9-14. Susu Fed:. 357 9-14.
11. Herman, L., and M. Heyndrickx. 2000. 11,. Herman L., dan Heyndrickx. 2000 M.. The presence of intragenically located REP-like elements in Bacillus sporothermodurans Bacillus sporothermodurans is sufficient for REP-PCR typing. Res. Microbiol. 151 : 255-261. [ PubMed ]
12. Herman, L., M. Heyndrickx, and G. Waes. 1998. Typing of Bacillus sporothermodurans Bacillus sporothermodurans and other Bacillus Bacillus species isolated from milk by repetitive element sequence based PCR. Lett. Appl. Microbiol. 26 : 183-188. [ PubMed ]
13. Herman, L., M. Vaerewijck, R. Moermans, and G. Waes. 1997. Identification and detection of Bacillus sporothermodurans Bacillus sporothermodurans spores in 1, 10, and 100 milliliters of raw milk by PCR. Appl. Environ. Microbiol. 63 : 3138-3143.
14. Heyndrickx, M., N. Rijpens, and L. Herman. 2001. Molecular detection and typing of foodborne bacterial pathogens: a review, p. 193-238. In In A. Durieux and J.-P. Simon (ed.), Trends in bio/technology. Applied microbiology. Kluwer Academic Publishers, Dordrecht, The Netherlands.
15. Heyndrickx, M., L. Vauterin, P. Vandamme, K. Kersters, and P. De Vos. 1996. Applicability of combined amplified ribosomal DNA restriction analysis (ARDRA) patterns in bacterial phylogeny and taxonomy. J. Microbiol. Methods 26 : 247-259.
16. Huemer, I., N. Klijn, H. Vogelsang, and L. Langeveld. 1998. Thermal death kinetics of spores of Bacillus sporothermodurans Bacillus sporothermodurans isolated from UHT-milk. Int. Dairy J. 8 : 851-855.
17. Kessler, HG, J. Pfeifer, and C. Schwöppe. 1994. Untersuchungen über hitze resistente mesophile Bacillus Bacillus-Sporen in UHT-Milch. Dtsch. Milchwirtsch. 13 : 588-592.
18. Klijn, N., L. Herman, L. Langeveld, M. Vaerewijck, A.Wagendorp, I. Huemer, and A. Weerkamp. 1997. Genotypical and phenotypical characterization of Bacillus sporothermodurans Bacillus sporothermodurans strains, surviving UHT sterilization. Int. Dairy J. 7 : 421-428.
19. Nociari, MM, M. Catalano, M. Torrero, and DO Sordelli. 1996. Pseudomonas aeruginosa Pseudomonas aeruginosa ribotyping: stability and interpretation of ribosomal operon restriction patterns. Diagn. Microbiol. Infect. Dis. 25 : 27-33. [ PubMed ]
20. Pettersson, B., F. Lembke, P. Hammer, E. Stackebrandt, and F. Priest. 1996. Bacillus sporothermodurans Bacillus sporothermodurans, a new species producing highly heat-resistant endospores. Int. J. Syst. Bact. 46 : 759-764.
21. Pitcher, DG, NA Saunders, and RJ Owen. 1989. Rapid extraction of bacterial genomic DNA with guanidium thiocyanate. Lett. Appl. Microbiol. 8 : 151-156.
22. Scheldeman, P., L. Herman, J. Goris, P. De Vos, and M. Heyndrickx. 2002. Polymerase chain reaction identification of Bacillus sporothermodurans Bacillus sporothermodurans from dairy sources. J. Appl. J. Appl. Microbiol. 92 : 983-991.
23. Skinner, GE, SM Gendel, GA Fingerhut, HA Solomon, and J. Ulaszek. 2000. Differentiation between types and strains of Clostridium botulinum Clostridium botulinum by riboprinting. J. Food Prot. 63 : 1347-1352. [ PubMed ]
24. Vaerewijck, MJM, P. De Vos, L. Lebbe, P. Scheldeman, B. Hoste, and M. Heyndrickx. 2001. Occurrence of Bacillus sporothermodurans Bacillus sporothermodurans and other aerobic sporeforming species in feed concentrate for dairy cattle. J. Appl. Microbiol. 91 : 1074-1084. [ PubMed ]
25. Vandamme, P., B. Pot, M. Gillis, P. De Vos, K. Kersters, and J. Swings. 1996. 25,. Vandamme P., B. Pot, M. Gillis, P. De Vos, K. Kersters, dan swings J.. 1996. Polyphasic taxonomy, a consensus approach to bacterial systematics. Microbiol. Rev. 60 : 407-438. [ PMC free article ] [ PubMed ]

Articles from Applied and Environmental Microbiology are provided here courtesy of
American Society for Microbiology (ASM)